Indian Tenders Tender information of India
Global Tenders International Tender information
Projects Project information of India
Tender Awarded Tender awarded information
Sub-Contractor Vendor information of India
Pay Online
Register now
Login
Contact Info All India : 9276083333 / 9274315555 South India : 9274315555

Filters

List of acetic acid solution Tenders

List of latest acetic acid solution Tenders in Indian Tenders. Click on any acetic acid solution Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for acetic acid solution Tenders.

All-Tenders (7)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :34278450 | 16 Apr, 2025

Tender Value : 0

Kangra - Himachal Pradesh

Tender for gem bids for potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g

Central Government/Public Sector

TRN :34237620 | 04 Apr, 2025

Tender Value : 0

Solapur - Maharashtra

Tender for supply of acetic acid solution 45754-500ml-f 500 ml , dimethyl sulfoxide 34869-500ml 500 ml , formic acid 98 percent - 100 percent 5.43804 100 ml , gallic acid 91215 100 mg , glucose go assay kit gago20 1 kit , pepsin from porcine gastric mucosa p7000-25g 25 g , pancreatin from porcine pancreas p1750-25g 100 g , amyloglucosidase from aspergillus niger 10115-1g-f 1 g , a-amylase from porcine pancreas a3176-500ku 500 ku , a-glucosidase from saccharomyces cerevisiae g5003-100un 100 un , 3,5- dinitrosalicylic acid 128848-5g 5 g , starch, soluble s9765- 100g 100 g , 4-nitrophenyl b-d-glucopyranoside n7006- 500mg 500 mg , sodium phosphate, monobasic 567545- 1kg 1 kg , sodium phosphate dibasic s9763-1kg 1 kg , acarbose a8980-1g 1 g , a-amylase from porcine pancreas a3176-500ku 500ku , a-glucosidase from saccharomyces cerevisiae g5003-100un 100un , 3,5-dinitrosalicylic acid 128848-5g 5g , starch, soluble s9765-100g 100g , 4- nitrophenyl b-d-glucopyranoside n7006-500mg 500mg , sodium phosphate, monobasic 567545-1kg 1kg , sodium phosphate dibasic s9763-1kg 1kg , acarbose a8980-1g 1g , punicalin a plus b mixture phl83532-10mg 10 mg , plus - catechin hydrate c1251-5g 5 g , caffeic acid c0625-2g 2 g , minus epicatechin e1753-1g 1 g , rutin phl89270-50mg 50 mg , ellagic acid e2250-1g 1 g , kaempferol 60010-25mg 25 mg , quercetin 3-glucoside 16654-10mg 10 mg , pcoumaric acid c9008-1g 1 g , cyanidin 3-glucoside chloride phl89616-10mg 10 mg , cynadin 3,5-diglucoside chloride phl89615-10mg 10 mg , pelargonidin 3-diglucoside chloride phl89753-10mg 10 mg , pelargonidin 3,5-diglucoside chloride phl80334-10mg 10 mg , liquid scintillation vials, plastic v6880-500ea 500 ea , nordihydroguaiaretic acid, greater than or equl to 97.0 percent hp and 74540-5g 5g

Central Government/Public Sector

TRN :34237656 | 04 Apr, 2025

Tender Value : 0

Solapur - Maharashtra

Tender for supply of ethanol absolute for analysis emsure 1.00983.1011 500 ml , acetonitrile for chromatogra 2 5 l 61803025001730 2.5 lt , methanol for chromatography 60600725001730 2.5 lt , ethanol 1.00983.0511 500ml , sodium silicate solution extra pure 1.05621.2500 1.05621.2500 2.5l , acetic acid 100percent for hplc 250 ml 5.43808.0250 250ml , methanol for analysis emparta acs 1.07018.2521 2.5l , acetonitrile for chromatography 2 5 l 61803025001730 2.5 lt , formic acid 98 - 100percent hplc 0 1 l 5.43804.0100 100 ml , formic acid 98-100 percent for analysis emparta acs 1.93015.0521 500 ml , ethyl acetate for chromatography 60086825001730 2.5 lt , copper standard solution traceable to srm from nist cuno32 in hno3 0 5 mol l 1000 mg l cu certipur 1.19786.0500 500 ml , iron standard solution traceable to srm from nist feno33 in hno3 0 5 mol l 1000 mg l fe certipur 1.19781.0500 500 ml , manganese standard solution traceable to srm from nist mnno32 in hno3 0 5 mol l 1000 mg l mn certipur 1.19789.0500 500 ml , zinc standard solution traceable to srm from nist znno32 in hno3 0 5 mol l 1000 mg l zn certipur 1.19806.0500 500 ml , ethanol absolute for analysis emsure 1.00983.1011 1 ea , acetonitrile 61803025001730 2.5 l , methanol 60600725001730 2.5 l

Central Government/Public Sector

TRN :34284008 | 19 Apr, 2025

Tender Value : 0

Ferozepur - Punjab

Tender for gem bids for dasatinib 50 mg tab , dengue test kit , diclofenac sodium 100 mg sr tab , diltiazem 60 mg tab , disposable insulin pen needles 4mm , distilled water , divalproex sodium cr 500 mg tab , dutasteride 0.5 mg tab , ed hydroxy propyl methylcellulose dextran glycerin polysorbate 80 with polyquad preservative eyemist , enalapril 2.5 mg tab , entecavir 0.5 mg tab , ed latanoprost plus timolol , ed pilocarpine , eye oint hypromellose 2 hydroxypropyl methylcellulose 2 per ocular lube , fenofibrate 145 mg tab , fenofibrate 200 mg tab , ed flurbiprofen sodium 0.3 percentage 5 ml , inh formoterol 6 mcg plustiotropium 9mcg mdi , frusemide 40 mg tab , gatifloxacin 0.3 percentage eye drop bott of 5 ml e d , ibuprofen syrup 100mg 5ml bott of 50 ml , indapamide sr 1.5 mg tab , insulin highly purified human neutral 40iu ml 10 ml inj regular , insulin highly purified isophane human nph 40iu ml10 ml inj , isabgol ispaghula husk 3.5 gm , isosorbide dinitrate 10 mg tab , kit for estimation of bilirubin 4x60ml , kit for estimation of cholestrol 5x20ml , kit for estimation of glucose 2x200ml , kit for estimation of hdl 2x50ml , kit for estimation of triglyceride 5x20ml , kit for estimation of uric acid 5x20ml , lamivudine 150 mg tab , lancet disposable with std , lotepredenol etabonate 0.5 per bott of 5 ml , malaria ag kit rapid , metformin 1000mg tab , methotrexate 5mg tab , methylcobalamin 500mg tab , micro tips 100 to 1000 ul pkt of 1000 , micro tips 5 to 50 ul pkt of 1000 , mirabegron 25mg tab , mycophenolate sodium 360mg tab , neomycin polymixin bacitracin neosporin powder , naphazolin 0.01 percentage ed , nevirapine 200 mg tab , nifedipine retard 20 mg tab , nitrofurantoin 100 mg cap , betamethasone 0.05 per salicylic acid 3 per oint , ondansetron 8 mg tab , oral teething sol 10ml , paracetamol syp 125mg 5ml , paradichlorobenzene 2 per benzocaine 2.7 per chorbutol 5 percentage turpentine oil 15 per ear drop , prasugrel 5 mg tab , prazosin sr 5 mg tab , pre-pro tab probiotic , printing thermal paper 110mm x 20mtr , pyridostigmine 60 mg tab , quetiapine 50 mg tab , rifaximine 400mg tab , rizatriptan 5 mg tab , ropinirole 0.5 mg tab , sodium valproate 300 mg tab , sterillium 500 ml bottle , sulphamethoxazole 400 mg plus trimethoprim 80mg tab , syp iron with vitamin b 12 and folic acid bottle of 200ml syp , azathioprine 100 mg tab , deflazacort 6 mg tab , hydralazine 37.5 plus isisorbide dinitrate 20 mg tab , lacosamide 100mg tab , mebeverine 135 mg tab , mebeverine 200mg tab , pantoprazole 40mg plus itopride 150mg cap , prednisolone 10mg tab , tamoxifen citrate 20 mg tab , telmisartan 20mg tab , tenofovir 300 emtricitabine 200mg efavirenze 600mg tab , test tube 100x12mm , tetrabenzeme 25mg tab , thiocolchicoside 4 mg myoril tab , thyroxine 50 mcg tab , timolol maleate eye drop 0.5 per bott of 5 ml , tolvaptan 15 mg tab , tramadol 50 mg plus paracetamol tab , tranexamic acid 500 mg plus mefenamic 250 mg tab , trypsin and chymotrypsin 6 1 100000 au enteric coated tab , uristick bott 100 strip , venlafaxine 37.5mg tab , vildagliptin 50mg tab , vitamin b complex therapeutic tab cap , widal test 4x5ml , ziprasidone 40 mg tab , zolpidem 5 mg tab , esr disposable piptte , 5 amino salicylic acid 400 mg , candid mouth paint clotrimazole , thiocolchicoside 8 mg tab , pramipexole 0.5 mg tab , torsemide 100 mg tab , prasugrel 10 mg tab , thyroxine 100 mcg tab , ezetimibe 10 mg tab , inj diclofenac 25mg ml 3ml , tadalafil 20mg tab , betahistine 16 mg tab , sitagliptin 50 mg tab plus metformin 1000 mg tab , colostomy paste , lamotrigine 100mg tab , levetiracetam 1000 mg tab , piracetam 800 mg tab , gliclazide 40 mg tab , prucalopride 1 mg tab , aceclofenac 100 mg tab , clobetasol plus neomycin cream , inj hepatitis b 10ml , zolpidem 10 mg tab , chlorthalidone 6.25 mg tab , leuprolide acetate 22.5 mg inj , clobetasol miconozole gentamycin oint , cefixime 200mg clavulanate 125 mg tab , fluticasone propionate 50 mcg bp nasal spray , ed moxifloxacin plus dexamethasone , eplerenone 50 mg tab , ed brinzolamide plus brimonidine , duloxetine 30 mg tab , faropenem 300mg extd relese tab , rifaximine 550 mg tab , gamma benzene hexachloride 1percentage cetrimide 0.1per lotion 100ml gbhc , tretinoin 0.05 percentage oint 60 gm , betamethasone plus gentamycin oint , fluvoxamine 50mg tab , methotrexate 7.5 mg tab , diltiazem cd 120 cap tab , desloratadine 5mg tab , inj darbepoetin 60 mg , mirabegron 50 mg tab , hbs ag kit , entacapone 200mg levodopa 150 mg carbidopa 37.5 tab syncapone 150 , digital x ray film 10 x 8 carestream , digital x ray film 12 x 10 carestream , serratiopeptidase 10mg tab , diclofenac 50mg pcm 500mg tab , isotretinoin 10 mg tab , chlorzoxazone 500mg diclofenac 50mg paracetamol 325mg tab , inj biovic 90mg sodium hyaluronate , syp azithromycin 200 mg 5ml , hydrochlorothiazide 25 mg tab , inj ondansetron 2 mg ml , pantoprazole 20 mg tab , chlordiazepoxide 10 mg tab , acebrophylline 200 mg sr , pirfenidone 200 mg tab , inj dicyclomine 20 mg , deferasirox 500 mg tab , midodrine 2.5 mg tab , eye oint ciprofloxacin , glycopyrronium 25 mcg smartules , alpha lipoic acid chromium folic acid methylcobalamin selenium zinc , inj normal saline 100 ml , sodium valproate 500 mg tab , isosorbid mononitrate 20 mg tab , cefoperazone so1gm , inj paracetamol 150mg ml 2ml iv , cetrizine 5mg paracetamol 325mg phenylephrine hcl 5mg , glucosamine 500 mg diacerin 50 mg tab , rivaroxaban 2.5 mg tab , spironolactone 50 mg tab , diclofenac plus paracetamol plus serratiopeptidase tab , naproxen 500 mg tab , efavirenz 600 mg tab , pantaprozole 40 mg plus domperidone 10 mg tab , inj lignocaine 2 percentage with adrenaline , glyceryl nitrate 2.6 tab , savlon liquid bott of 1 ltr , amitryptalline 25 mg tab , bromhexine 100 ml syp , nortriptyline 10 mg tab , crp kit span , sgpt kit erba , ofloxacin orninizole itraconazole clobetasol orniderm cream , syp cefixime 50 mg , perampanel 4 mg tab , biphasic isophane insulin 30 as soluble insuline70 isophan insulin suspension 100iu 3 ml mixtard 30 cart , kit for estimation of alkaline phosphate 10x2.2ml , memantine 10 mg tab , glucosamine 750 mg diacerine 50 mg msm 200 mg tab , capillary tube , aceclofenac 100 paracetamol 325 chloroxazone 250 tab , ear drop chloramphenicol 5per clotrimazole 1 betamethasone 0.25lignocaine hcl 2per in bottle of 5 ml , sumatriptan 85 mg naproxen 500 mg tab , hcv test kit pkt of 25 test , tolperisone sr 150 mg tab , normal saline 1000 ml , inj zoledronic acid 4 mg , inj methylcobalamin 1500 mcg , dexamethasone 4mg tab , ed netarsudil 0.02 percentage , brivaracetam 75 mg tab , nicorandil 5 mg tab , olmesartan 40 mg tabdium 1gm and sulbactum sodium

Central Government/Public Sector

TRN :34280369 | 18 Apr, 2025

Tender Value : 0

Ferozepur - Punjab

Tender for gem bids for levodopa 200 mg plus carbidopa 50 mg cr tab , ranolazine sr 500 mg tab , pancreatin 10000 iu tab , colchicine 0.5 mg tab , clindamycin 1 perc gel 10 gm , propranolol tr 40 mg tab , sulphasalazine 500 mg tab , brimonidine 0.2 perc plus timolol 0.5 perc eye drops , cap vitamin ginsing mineral antioxidant , tab aceclofenac paracetamol serratiopeptidase , tab l glutamine 500 mg , glutathione 50 mg cap , povidone plus iodine mouth gargle , tab trigabantin 300 mg gabapentin methylcobalamine alpha lipoic acid , tab cabergolin 0.5 mg , cap natural vitamin e plus vitamin c softgel , tab spironolactone 25 mg , tab teneligliptin 20 mg , tab gimepiride 2 mg plus voglibose 0.2 mg plus metformin 500 mg , glusine apidra inj , desensivity tooth paste , e d olopetadine , e d ketorolac , lotion calamine 100 ml , protien powder bott of 200 gm , erba wash 4 multi 50ml , albumin kit 5 multi 50ml , cleanac 3 pack of 2 ltr , total protien kit 5 multi 50ml , ra factor 1 multi 1ml , pm kit , hemolynac 3n bott of 500 ml , l ornithine l aspartame sachet , cleanac can of 5ltr , clove oil , sodium citrate esr tube , tab thiocolchicoside plus aceclofenac , tab telmisartan 80 mg , oral rehydration salt ors , syp piracetam 500 mg 5ml , benzoly peroxide 2.5 tube of 20 gm , salicylic acid 3-5 perc and coal tar 1-3 perc soln bott of 60 ml , gel kojic acid dipalmitate 2.5 perc, arbutin1.5 perc octinoxate 7.5 perc and mulberry extract1 perc tube of 15 gm , lotion minoxidil 5 perc aminexil 1.5 perc topical solution bott of 60 ml , flucinolone acetonide shampoo 0.01 perc bott of 100 ml , white soft paraffin 13.2 ang light liquid paraffin 10.2 perc glycerine 1 containing cream base jar of 300 gm , lotion halobetasol 0.05 bottle of 30 ml , lotion glycerin bott of 400 ml , tab zinc 50 mg , acebrophyllin 100mg acetycstine 600mg pulmoclear tab , acetaminophen 325 mg plus tramadol 37.5 mg ultracet tab , alovera and vitamin e lotion , alprazolam 0.5 mg tab , amitriptyline 10 mg tab , aripiprazole 5 mg tab , aspirin 75 mg plus atorvastatin 10 mg plus clopidogril 75 mg tab , aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , asthalin respules levolin resp , azelasartan 40 mg tab , baclofen 20 mg tab , betahistine 24 mg tab , brivaracetam 100mg tab , calcium vit d3 syp 200ml bott , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , capesitabine 400mg plus cyclophosphamide 20mg tab , carbamazepine 200 mg cr tab , cefuroxime 500mg plus clavuclonic acid 125 mg tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg , chlorhexidine mouthwash 2 perc bottle of 150 ml , cilinidium plus chlordiazepoxide plus dicyclomine tab , cinitapride 3mg plus pantoprazole 40mg tab , clarithromycin 250mg tab , clobetasol plus gentamicin oint , clonazepam 2 mg tab , clopidogrel 75 mg plus aspirin 75 mg tab , clozapine 100 mg tab , coenzyme q10 100 mg tab , coenzyme q300 mg tab , collagen peptide plus hyaluronate tab , combipack of amoxicillin 750mg plus tinidazole 500 mg plus omeprazole 20 mg hp kit , daflon 500mg diosmin 450mg plus hesperidin 50mg tab , dapagliflozin 10 mg plus metformin 500 mg tab , dienogest 2mg tab , disodium hydrogen citrate syrup , donepezil 5mg plus memantine 10mg tab , drotaverine hcl 40 mg tab , ed bimatoprost 0.01 perc , ed nepafenac 0.1perc w v , ed olopatadine plus ketorolac bott of 10ml , ed potassium iodide sodium chloride and calcium chloride calodin 5 ml , ed travaprost plus timolol bott of 10ml , enteral feed powder protein 85 perc short chain peptides 15perc free amino acids fat 50 perc mct 25 perc vet fat carbohydrate malto destri sht of 126gm , eperisone 50 mg tab , escitalopram 5 mg plus clonazepam 0.5 mg , escitalopram 5 mg plus clonazepam 0.5 mg tab , evening primarose 1000 cap , fenofibrate 200mg plus atorvastatin 10mg tab , flupentixol 0.5 mg plus melitracen 10 mg tab , flurbiprofen 0.03 perc eye drop , fungal diastace plus papaine plus activated charcol unienzyme , ginkgo biloba tab , glimepiride 2mg metformin 500mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glucose powder , heparin 15g 20g oint , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu ml 3 ml pfs , hydrochlorothiazide 12.5 mg tab , indapamide 1.5mg tab , inh beclomethason 200mcg 200 meter dose inh , inh salmeterol 25mcg plus fluticasone 125mcg 120 mdi , inh triohale tiotropium bromide 9 mcg plus formoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj degludec insulin aspart ryzodeg , inj filgrastim 300 mcg , inj human mixtard 30-70 , inj insulin liraglutide 6mg ml 18mg pen , insulin humalog lispro inj recombinan dna origin 100iu mlcartidge , isosorbid 5 mg monontrate 30 mg tab , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 5 mg tab , ketoconazole shampoo , ketoralac 0.2 perc e d , l carnitine 500mg tab , levocarnitine 500 mg tab , lignocain plus gabapentin oint , linagliptin 5 mg plus empagliflozin 10 mg tab , liq paraffin 100 ml bott , losartan 50mg plus hydrochlorthiazide 12.5mg tab , memantine 5 mg plus donepezil 5 mg tab , mesalamine 400 gm tab , metolazone 2.5 mg tab , metoprolol xl 12.5 mg tab , midodrine 10mg tab , minoxidil 5 perc w v lotion 60 ml , mirabegron 25mg plus solifenacin 5mg tab , mirtazapine 7.5 mg tab , montelukast plus levocetrizine plus acebrophylline 200mg tab , multivitamin plus multimineral tab , multivitamin syp , nandrolone deconate 50 mg inj , nasal spray calcitonin 200iu , nepafenac 0.3 perc w v5 ml ed , nifedipine retard 10 mg tab , nitroglycerin 2.6 mgtab , omega 3 fatty acid cap , omega fatty acid plus antioxidant cap , powder clotrimazole 75 gm , propranol 40 mg tab , rabeprazole 20 mg plus levosulpride 75mg tab , rabeprazole 20mg plus domeperidon 10mg tab , ramipril 5 mg plus hydochlorothiazide 12.5 mg tab , risperidone 1 mg tab , rosuvastin 10 mg plus aspirin 75mg plus clopidogrel 75 mg tab , s adenosyl l methionine 200 mg tab , safinamide 50 mg tab , salicylic acid plus coal tar oint 40 gm , sod valproate 200 mg cr tab , sodium hyaluronate 0.1 perc eye drops e d , sodium hypochlorite 5 perc solution , solifenacin 10 mg tab , spirit bott of 100ml , spironolactone 25 mg plus frusemide 20 mg tab , syp alpha amylase pepsin digestive enzyme , syp liver tonic , tab sodium valproate 500 mg crsodium valproate 333 mg plus valproic acid 145mg , tacrolimus 2 mg tab , tamoxifen 10 mg tab , taurine 500mg acetylcystine 150mg , telmisartan 40 plus amlodipine 5 mg tab , telmisartan 80 mg plus hctz 12.5mg tab , theophylline 400 mg tab , thyroxin 125 mcg tab , thyroxine 12.5 mcg tab , triamcinolone 0.1 perc oral paste , trimetazidine 60 sr tab , vericiguat 2.5 mg tab , warfarin 2mg tab , xylometaloline hcl 0.05 perc w v nasal drops , tab fexofenadine 120mg plus montelukast 10mg , salbutamol respiratory solution bott of 15ml , tab ebastine plus montelukast , tab vildagliptine 100mg plus dapagliptine 10mg , eperisone 150mg , tab doxophylline 400mg plus montelukast 10mg , tab liv 52 , tab clostrum 500mg , ecg recording bpl 9108-d mch packet of 150 , tab abiraterone 1gm , magestrol 40mg 240ml oral suspension , iridoforce rosehip ext vit c bosewella , tab zinc plus mecobalamine plus pyridoxine plus fa plus niacanamide and chrnium , sitagliptin 100 mg tab plus metformin 1000 mg tab , inj sodium hyaluronate 60mg , tab carica papaya , tab diclofenac 50 mg plus paracetamol 325mg , ethambutol 400 mg tab , syp hemosef , tissue paper roll , hiv i and ii rapid card test pack of 50 test

Central Government/Public Sector

TRN :34274012 | 15 Apr, 2025

Tender Value : 0

Ambala - Haryana

Tender for gem bids for tab ropinirole 2mg , tab rosuvastatin 10mg , tab rosuvastatin 20mg , tab rosuvastatin 40mg , tab s amlodipine 2 point 5mg , tab s-adenosyl l methionine 200mg , tab salbutamol 4mg , tab serratiopeptidase 10mg , tab sildenafil citrate 25mg , tab sitagliptin phosphate 50mg , tab sodium bicarbonate 1000mg , tab sodium valproate cr 200mg , tab sodium valproate cr 300mg , tab solifenacin 10mg , tab tadalfil 20mg , tab tamsulosin 0 point 4mg plus dutasteride 0 point 5mg , tab telmisartan 20mg , tab telmisartan 40mg plus amlodipine 5mg , tab telmisartan 80mg , tab tenaligliptin 20mg , tab thiocolchicoside 4mg , tab thyroxin sodium 12 point 5mcg , tab tolvaptan 30mg , tab torsemide 20mg , tab trimetazidine 20mg , tab trimetazidine mr 35mg , tab valacyclovir 1gm , tab verapamil 40mg , tab voglibose 0 point 3mg , tab warfarin 1mg , tab zinc plus multivitamin , eye drop moxifloxacin hydrochloride and dexamethasone phsphate opthalmic solution with droptainer sysytem with 10 ml equivalent to moxifloxacin 5mg and dexamethasone 1mg in 1ml , inj filgrastim 300mcg , tab methyl prednisolone 8mg , tab capacitabine 500mg , cap lenvatinib 4mg , tab cabozantinib 40mg

Central Government/Public Sector

TRN :34231766 | 07 Apr, 2025

Tender Value : 0

Kolkata - West Bengal

Tender for supply of inj 3percentage sodium chloride 100ml bottle , ranitidine hcl 50 mg coma 2 ml inj , tranexamic acid 500 mg oblique 5ml inj , inj thiamine 100mg oblique ml coma 2ml amp , multi vit inj iv 2 to 10 ml with minimum constituents having thiamine b1 30mg oblique ml coma pyridoxine b6 30mg oblique ml and b12 cyanocobalamin 300mcg oblique ml , inj fosphenytoin 75 mg oblique ml 2 ml amp , ceftazidime 2 gm plus avibactam o point 5 gm zavicefta 2 point 5 gm , inj azithromycin 500 mg , clindamycin 300 mg oblique 2ml inj , metronidazole inj for iv use containing 500 mg per bott of 100 ml , acyclovir 250 mg inj , inj levonadifloxacin 800 mg , artesunate 60 mg inj , sodium valproate 100 mg oblique ml inj , dexamethasone sodium phosphate 4 point 4 mg coma equivalent to dexamethasone phosphate 4 mg oblique ml 2 ml inj , metoclopramide hcl 5mg oblique ml coma 2ml inj , calcium 9mg plus calcium gluconate 50mg inj for iv use 10 ml injection , prazosin 5 mg sustained release oblique slow release tab , tab perindopril 8mg , tab oseltamavir phosphate 75 mg , haloperidol 5mg oblique ml inj , lorazepam 2mg oblique ml coma 2 ml inj , dextrose 25 percentage coma 25ml inj , dextrose 50 percentage coma 25ml inj , cremaffin white each 15 ml containing milk of magnesia 11 point 25 ml coma liq paraffin 3point 75 ml bottle of 170ml , potassium chloride liquid 20 percentage bott of 200 ml , inj etomidate 2mg oblique ml 10ml vial , dexmedetomidine 100 mcg oblique ml inj , rocuronium 10 mg oblique ml 10ml vial inj , succinylchloline chloride 50 mg oblique ml coma 2 ml inj , disposable nasal suction cannula , levetiracetam 500mg oblique ml vial inj , mometasone aqueous nasal spray 50 mcg , inj doxycycline 100 mg , human insulin analogue glargine inj 100iu oblique ml recombinant dna origin 300iu disposable pen with 5 needles per pen , fentanyl 50mcg oblique ml 10 ml inj , diltiazem 60 mg tab , ramipril 2 point 5 mg tablet , e oblique d paradichlorobenzine 2 percentage plus benzocaine 2 percentage plus chlorbutol 5 percentage plus turpentin oil 15 percentage 10 ml bottle waxol ear drop , tab efavirenz 600 mg , glyceryl trinitrate cr 2 point 6 mg, tab , miconazole nitrate 2 percentage 15 g tube , ketorolac tromethamine 0 point 4 percenatge eye drop , clozapine 100 mg tab , frusemide 40 mg tab , tab tadalafil 10 mg , carbimazole 5 mg tab , enalapril 5 mg tab , tab syndopa 110 mg levodopa 100 mg plus carbidopa 10 mg , deferasirox 400 mg coma tab , calcium acetate 500mg tab , vitamin d3 200 iu oblique ml drops , tab septran ds 800mg plus 160mg , trypsin with chymotrypsin tab , tab sodium valproate cr 300 mg , levo-salbutamol syrup 1 mg oblique 5ml bottle of 100 ml , syrup ranitidine 75 mg oblique 5 ml coma bottle of 100 ml , alprazolam 0 point 25 mg tab , tab modafinil 100mg , ceftriaxone 1000 mg plus disodium edetate 37 mg plus sulbactam 500 mg inj , ceftriaxone 2000 mg plus disodium edetate 74 mg plus sulbactam 1000 mg inj , inj colistimethate sodium coma 1 million unit , human rabies immune globulin 150 iu oblique ml coma 2 ml vial , inj sildenafil citrate 10 mg oblique 12 point 5ml vial , cholecalciferol vit d3 oral solution coma 800 iu oblique ml coma 15ml bottle , caffeine citrate syrup 20mg oblique ml 3ml syp , inj caffeine 20 mg oblique ml each vial containing 3 ml , fluvoxamine 50 mg tab , risperidone 2mg tab , resperidone 1 mg oblique ml syp in bott of 30 ml , tab endoxifen 08 mg , tab quetiapine 100 mg , tab ziprasidone 20 mg , tab ziprasidone 40 mg

1

Related Searched Keywords : acetic acid solution

Get acetic acid solution Tender Alert...

Related Searched Keywords : acetic acid solution

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

Copyright ©2018 - Thetenders.com. Read Policies